The short version of Degree of hydrolysis fits in a sentence. The long version — which is the one that helps — is below.
Reviewed 2026-04-05. Anything still debated is marked as such rather than presented as settled.
Hydrolysates usually contain 70% to 90% protein on a dry basis, with variable ash, fat, and carbohydrate. Solubility in water is generally high over a broad pH range, though bitter notes can appear from exposed hydrophobic peptides. The powder tends to absorb moisture and may brown during prolonged warm storage. Applications span sports nutrition, clinical nutrition, infant formulas, and flavor systems. Regulatory status and labeling rules differ by country. A key open question is whether a given peptide profile reliably predicts functional or sensory behavior across different food matrices.
Whey protein hydrolysate is a dairy ingredient made by breaking peptide bonds in whey proteins. Enzymes such as proteases, or in some processes acid or heat, cleave the protein chains into shorter peptides and free amino acids. The starting material may be sweet whey, acid whey, whey protein concentrate, or whey protein isolate. Because raw materials and reaction conditions differ, the final mixture is not a single uniform substance. Its peptide profile, mineral content, and residual lactose depend on the source and the processing steps used.
Production typically begins with pasteurization and concentration of whey. A protease is added under controlled temperature and pH, and the reaction is stopped by heat or pH change when the target extent of cleavage is reached. Ultrafiltration or diafiltration may remove enzymes, salts, and small molecules. The liquid is then spray dried into a powder. Process parameters shape bitterness, solubility, and peptide size. Established control points include enzyme type, reaction time, and inactivation conditions. How these variables interact across large-scale batches remains an area of active process development.
Whey protein hydrolysate appears in foods, infant formula, sports nutrition, and specialized clinical nutrition. Its production can reduce viscosity and improve heat stability compared with intact whey protein. Bitterness is common because short hydrophobic peptides can activate bitter taste receptors. The ingredient is not the same as free amino acids; it remains a mixture of peptides of different lengths. Composition varies by supplier, enzyme, and process, so two hydrolysates with the same protein content may behave differently in a formulation.
Whey protein hydrolysate is a dairy ingredient made by treating whey protein with enzymes or, less often, acid or heat to break peptide bonds. The starting material is typically sweet whey or acid whey from cheese making, first concentrated and dried into whey protein concentrate or isolate. Hydrolysis shortens long protein chains into smaller peptides, changing functional properties such as solubility, viscosity, and foam formation. The resulting powder contains peptides, residual intact protein, moisture, minerals, and variable amounts of lactose and fat depending on the starting material.
Enzymatic hydrolysis usually uses proteases from microbial, plant, or animal sources. The enzyme choice, pH, temperature, and reaction time determine which peptide bonds are cleaved and the final peptide profile. After hydrolysis, the enzyme is inactivated by heat, and the mixture is clarified, filtered, concentrated, and spray-dried. Manufacturers may use ultrafiltration to remove larger peptides or minerals. The degree of hydrolysis, often reported as a percentage, describes the proportion of peptide bonds broken. A higher degree generally means shorter peptides, but it does not by itself define taste, allergenicity, or biological activity.
| Property | Value | Notes |
|---|---|---|
| Appearance | Off-white to pale yellow powder | Color varies with whey source and drying. |
| Protein content | 75–90% of dry matter | Depends on raw material and filtration. |
| Hydrolysis extent | 5–35% cleaved bonds | Ranges overlap product types; assay-dependent. |
| Water solubility | High across pH 3–7 | Hydrolysis raises solubility versus intact protein. |
| Typical storage | 15–25 °C, dry | Keep sealed; limit moisture and heat. |
The parent whey proteins include beta-lactoglobulin, alpha-lactalbumin, serum albumin, immunoglobulins, and glycomacropeptide, depending on the whey source. Hydrolysis does not remove these sequences; it fragments them into peptides of varying length. The peptide distribution depends on the enzyme specificity, reaction time, temperature, pH, and enzyme-to-substrate ratio. Because the mixture is heterogeneous, a single molecular weight cannot describe the product. Instead, laboratories report a distribution, often spanning from a few hundred to several thousand daltons.
Whey protein hydrolysate appears in foods and supplements where rapid digestion, low viscosity, or reduced intact-protein content is desired. It is distinct from whey protein isolate and concentrate, which contain largely intact proteins, though hydrolysates can be made from either. In infant formula, extensively hydrolyzed whey is used in some specialty products, while partially hydrolyzed forms appear in other formulations. Human health effects depend on the specific peptide mixture and are not uniform across all hydrolysates.
Whey protein hydrolysate is a dairy ingredient produced when whey proteins are treated with proteolytic enzymes or, less commonly, acid or heat under controlled conditions. The treatment cleaves peptide bonds and yields shorter peptide chains than those found in intact whey protein. The starting material is usually sweet whey or acid whey from cheese manufacture, concentrated by membrane filtration before hydrolysis. The resulting ingredient retains many amino acids from the original protein but differs in molecular size, solubility, and taste profile.
Whey protein hydrolysate is a dairy ingredient produced by treating whey protein concentrate or isolate with proteolytic enzymes, acids, or heat under controlled conditions. The process cleaves peptide bonds and reduces average peptide size compared with intact whey proteins. Products are often described by degree of hydrolysis, which estimates the percentage of peptide bonds broken. Hydrolysates occupy a distinct category from concentrates and isolates because their peptide profile, solubility, and taste differ, even when the parent protein source is similar. Commercial production typically begins with pasteurized whey, followed by filtration, enzymatic treatment, inactivation, and drying.
Enzyme choice, pH, temperature, time, and substrate concentration influence the resulting peptide distribution. Endopeptidases cut internal peptide bonds, while exopeptidases remove terminal amino acids and can reduce bitterness. Manufacturers may combine enzymes or use membrane filtration to select peptide size ranges. A higher degree of hydrolysis generally means more small peptides and free amino acids, but it does not by itself define biological activity or nutritional quality. Batch-to-batch variation arises from raw whey composition, enzyme specificity, and processing parameters, so specification ranges are common in commercial supply.
Whey protein hydrolysate is a dairy ingredient made by treating whey protein concentrate or isolate with proteases that cleave peptide bonds. The resulting mixture contains shorter peptides and free amino acids than intact whey protein. Commercial products vary widely in average peptide length, residual intact protein, lactose, fat, and minerals. The term hydrolysate does not imply a single fixed composition, because enzyme choice, reaction time, pH, and temperature all shape the final peptide distribution. Products are often described by degree of hydrolysis, a percentage estimate of cleaved peptide bonds.
Production begins with pasteurized whey, which is concentrated and sometimes defatted or demineralized before hydrolysis. Food-grade proteases, such as trypsin, chymotrypsin, pepsin, or microbial enzymes, are added under controlled conditions. After a target degree of hydrolysis is reached, the enzymes are inactivated by heat or pH adjustment. The liquor is then clarified, concentrated, and dried, usually by spray drying. Ultrafiltration or diafiltration may remove residual enzymes, salts, or very small peptides, depending on the intended specification.
The peptide profile affects functional behavior more than the total protein content alone. Short peptides can be more soluble across a range of pH values and may form clearer solutions than intact whey proteins. Bitterness often rises with higher degrees of hydrolysis because certain hydrophobic peptides are exposed. Foaming, gelation, and heat stability also change as molecular size decreases. These functional shifts make hydrolysates useful in beverages, clinical nutrition, and specialty foods, though the exact relationship between peptide sequence and sensory or physical properties remains an active area of study.
Enzyme choice influences the peptide size distribution and the resulting functional properties. Some proteases cut at specific amino acid residues, while others act more broadly, so two hydrolysates with the same degree of hydrolysis can differ in peptide sequences. Short peptides are generally more water-soluble and less likely to form gels under heat, although bitterness can increase when hydrophobic residues become exposed. The relationship between peptide length, taste, and bioactivity is an active area of study, and not all proposed effects are established in human trials.
Composition tables often report protein content on a dry basis, ash, moisture, fat, and lactose. Because hydrolysis adds water to peptide bonds, the total mass yield can appear slightly higher than the original protein if residual salts and water are counted. Some products are further processed by ultrafiltration, spray drying, or decolorization, which alters mineral content and flavor. Product labels may distinguish partially hydrolyzed from extensively hydrolyzed whey, but these terms are not always defined by a single numerical threshold across regions.
A small minority still support the wall or even support rebuilding the wall back up. A 2008 poll found that 11% of participants from the former West Berlin and 12% from the former East Berlin said it would be better if the wall was still in place. A November 2009 poll found that 12% of Germans said the wall should be rebuilt. The poll also found that in the former West German states support was at 12% and in the former East German states it was 13%. A September 2009 poll found 15% of Germans supported a wall, while in the west it was 16% and in the east it was at 10%. A 2010 poll from Emnid for Bild found that 24% of West Germans and 23% of East Germans wished for the wall to remain. A 2011 poll from Berliner Zeitung on the 30th anniversary of the fall of the Berlin Wall found that 8% of Berliners opposed the fall, while 87% supported the fall. The poll also found that 28% of Alternative for Germany (AfD) and 16% of Free Democratic Party (FDP) supporters supported bringing back the wall. A 2019 Yougov poll found that 13% of Germans wanted the wall back; in the West support was at 14%, and in the East it was 13%. A 2019 poll from Forsa found 35% of Berliners thought the construction of the wall was not bad, with supporters of Die Linke at 74%.
Militarily, the Combine make use of both synthetics, creatures augmented with machinery, and traditional machines such as armored personnel carriers and attack helicopters. The most prominent of the synthetic machines are the insect-like gunships; and Striders, 50-foot-tall (15 m) armored creatures which walk on three legs and are armed with a high powered cannon and a head-mounted pulse turret. In Episode Two, the Hunter, a smaller equivalent to the Strider, is introduced. These tripodal assault machines fire explosive flechettes at targets and are small enough to maneuver indoors. Other synths are seen near the end of the Half-Life 2, though their roles are not elaborated on. Sentry turrets are also used by the Combine. The Combine often uses headcrabs as a method of bioterrorism against dissidents and refugees, firing artillery shells loaded with the creatures into areas and allowing them to infest said area.
Prolactin-releasing hormone, also known as PRLH, is a hypothetical human hormone or hormone releasing factor. Existence of this factor has been hypothesized as prolactin is the only currently known hormone for which almost exclusively negative regulating factors are known (such as dopamine, leukemia inhibitory factor, some prostaglandins) but few stimulating factor. Its secretion is mediated by estrogen from placenta during pregnancy to elevate blood level of prolactin. While many prolactin stimulating and enhancing factors are well known (such as thyrotropin-releasing hormone, oxytocin, vasoactive intestinal peptide and estrogen) those have primary functions other than stimulating prolactin release and the search for hypothetical releasing factor or factors continues. The prolactin-releasing peptide identified in 1998 was a candidate for this function, however as of 2008 it appears its function is not yet completely elucidated.
The country restored its independence in 1813 and recalled William V's son, William Frederick, from exile; he formally established the modern Kingdom of the Netherlands in 1815 as King William I, and securing the dynastic continuity of the House of Orange-Nassau that extends to the reigning monarch today, Willem Alexander.
== Further reading == Nualart F, Rivas C, Montecinos V, Godoy A, Guaiquil V, Golde D, Vera J (2003). "Recycling of vitamin C by a bystander effect". J Biol Chem. 278 (12): 10128–33. doi:10.1074/jbc.M210686200. hdl:10533/174378. PMID 12435736.
Sources: en.wikipedia.org
In pre-life, a 31 nucleotide D loop minihelix (GCGGCGGUAGCCUAGCCUAGCCUACCGCCGC) was ligated to two 31 nucleotide anticodon loop minihelices (GCGGCGGCCGGGCU/???AACCCGGCCGCCGC; / indicates a U-turn conformation in the RNA backbone; ? indicates unknown base identity) to form the 93 nucleotide tRNA precursor. To generate type II tRNAs, a single internal 9 nucleotide deletion occurred within ligated acceptor stems (CCGCCGCGCGGCGG goes to GGCGG). To generate type I tRNAs, an additional, related 9 nucleotide deletion occurred within ligated acceptor stems within the variable loop region (CCGCCGCGCGGCGG goes to CCGCC). These two 9 nucleotide deletions are identical on complementary RNA strands. tRNAomes (all of the tRNAs of an organism) were generated by duplication and mutation. Very clearly, life evolved from a polymer world that included RNA repeats and RNA inverted repeats (stem-loop-stems). Of particular importance were the 7 nucleotide U-turn loops (CU/???AA). After LUCA (the last universal common (cellular) ancestor), the T loop evolved to interact with the D loop at the tRNA "elbow" (T loop: UU/CAAAU, after LUCA). Polymer world progressed to minihelix world to tRNA world, which has endured for ~4 billion years. Analysis of tRNA sequences reveals a major successful pathway in evolution of life on Earth.
American black bears were once not considered true or "deep" hibernators, but because of discoveries about the metabolic changes that allow black bears to remain dormant for months without eating, drinking, urinating or defecating, most biologists have redefined mammalian hibernation as "specialized, seasonal reduction in metabolism concurrent with scarce food and cold weather". American black bears are now considered highly efficient hibernators. The physiology of American black bears in the wild is closely related to that of bears in captivity. Understanding the physiology of bears in the wild is vital to the bear's success in captivity. The bears enter their dens in October and November, although in the southernmost areas of their range (i.e. Florida, Mexico, the southeastern United States), only pregnant females and mothers with yearling cubs will enter hibernation. Prior to that time, they can put on up to 14 kg (30 lb) of body fat to get them through the several months during which they fast. Hibernation typically lasts 3–8 months, depending on regional climate. Hibernating bears spend their time in hollowed-out dens in tree cavities, under logs or rocks, in banks, caves, or culverts, and in shallow depressions. Although naturally-made dens are occasionally used, most dens are dug out by the bear. During their time in hibernation, an American black bear's heart rate drops from 40 to 50 beats per minute to 8 beats per minute, and the metabolic rate can drop to a quarter of the bear's (non-hibernating) basal metabolic rate.
== History == Protein C's anticoagulant role in the human body was first noted by Seegers et al. in 1960, who gave protein C its original name, autoprothrombin II-a. Protein C was first isolated by Johan Stenflo from bovine plasma in 1976, and Stenflo determined it to be a vitamin K-dependent protein. He named it protein C because it was the third protein ("peak C") that eluted from a DEAE-Sepharose ion-exchange chromotograph. Seegers was, at the time, searching for vitamin K-dependent coagulation factors undetected by clotting assays, which measure global clotting function. Soon after this, Seegers recognised Stenflo's discovery was identical with his own. Activated protein C was discovered later that year, and in 1977 it was first recognised that APC inactivates Factor Va. In 1980, Vehar and Davie discovered that APC also inactivates Factor VIIIa, and soon after, Protein S was recognised as a cofactor by Walker. In 1982, a family study by Griffin et al. first associated protein C deficiency with symptoms of venous thrombosis. Homozygous protein C deficiency and the consequent serious health effects were described in 1984 by several scientists. cDNA cloning of protein C was first performed in 1984 by Beckmann et al. which produced a map of the gene responsible for producing protein C in the liver. In 1987 a seminal experiment was performed (Taylor et al.) whereby it was demonstrated that activated protein C prevented coagulopathy and death in baboons infused with lethal concentrations of E. coli. In 1993, a heritable resistance to APC was detected by Dahlbäck et al.
In the above formula, the superscripts "ionized" each indicate the sum of concentrations of all ionized species in their respective phases. In addition, since log D is pH-dependent, the pH at which the log D was measured must be specified. In areas such as drug discovery—areas involving partition phenomena in biological systems such as the human body—the log D at the physiologic pH = 7.4 is of particular interest. It is often convenient to express the log D in terms of PI, defined above (which includes P0 as state I = 0), thus covering both un-ionized and ionized species. For example, in octanol–water:
Sources: en.wikipedia.org
Hydrolysis extent indicates the share of peptide bonds that have been cleaved. It is often estimated from free amino groups and is reported as a percentage. A higher value means smaller peptides and more free amino acids, but it does not by itself define product quality.
No. Whey protein isolate is a filtered protein ingredient with most lactose and fat removed. Hydrolysate refers to protein that has been treated to break peptide bonds, and it can be made from isolate, concentrate, or whey itself.
Not directly. Lactose content depends mainly on the starting material and filtration steps. A hydrolysate made from isolate is typically lower in lactose than one made from sweet whey.
It is whey protein that has been partially broken down into smaller peptides through hydrolysis. The powder still contains a mixture of peptides, residual protein, minerals, and other whey components. It is used as a food ingredient rather than a single pure compound.